Chalkhills Digest Volume 7, Issue 35
Date: Saturday, 9 June 2001
Chalkhills Digest, Volume 7, Number 35
Saturday, 9 June 2001
Topics:
XTC videos online and their music in my grocery store
Re:issues
More Metal and XTC
ES single version
Under New Management...(Limited XTC Content)
R.E.M. and XTC
Enough about Homespun/Homegrown!
Re: newsgrope
AC?
collecting XTC/blegvad/dave/misc
Blighty? Blimey!
XTC ON UK TELLY
Remastered 'Fab Four In Philly' (FREE! XTC CONCERT!)
"It's very niiice ... but he's already got one."
Re: SPOILER WARNING: Japanese reissues part 2
Partridge Manipulation
A few thoughts
bonus sleeve
(Hear it) Read It In The Sunday Papers
UNCUT
XTC on french radio
Atlanta Venus Vol. III
Trip to Swindon
Homegrown
Re: Issues
Administrivia:
To UNSUBSCRIBE from the Chalkhills mailing list, send a message to
<chalkhills-request@chalkhills.org> with the following command:
unsubscribe
For all other administrative issues, send a message to:
<chalkhills-request@chalkhills.org>
Please remember to send your Chalkhills postings to:
<chalkhills@chalkhills.org>
World Wide Web: <http://chalkhills.org/>
The views expressed herein are those of the individual authors.
Chalkhills is compiled with Digest 3.7c (John Relph <relph@tmbg.org>).
And beer tastes good in tins.
----------------------------------------------------------------------
Date: Sun, 3 Jun 2001 23:52:41 -0400
From: "Patrick Adamek" <padamek@neo.rr.com>
Subject: XTC videos online and their music in my grocery store
Message-ID: <003901c0eca9$ceb3ec60$79c55d18@neo.rr.com>
Greetings Chalkhills' observers
I wanted all to know that Launch.com has three XTC videos (in their
entirety!) available for viewing. If this was already known forgive me but
it was the first time that I saw any three of the following:
The Mayor of Simpleton
The Dissapointed
Wonderland
You just have to search for "XTC" and those three choices come up. Oh,
and you have to "register" (no charge that I could see) before viewing them.
The faster internet connection you can find the better, and there is even a
"full screen" mode available which functioned quite well on my cable modem
equipped 21" screen.
Also: while shopping a Krogers supermarket and immediately following an
obscure Rolling Stones song, Stupidly Happy was played on the PA system.
Some idiot asked for a price check at the 1:00 minute mark and then someone
else told Bob that he had a call on line 3 at about the 2:00 minute mark,
but all in all it was delightful to hear our heroes in such a public place.
I thought for a minute that if I was in another life, maybe listening to XTC
while you shop wouldn't be so rare and noteworthy. Dream on.
Until then,
Patrick
------------------------------ Date: Mon, 04 Jun 2001 18:31:14 -0000 From: "pop boy" <powerpopboy67@hotmail.com> Subject: Re:issues Message-ID: <F32DaCdhxJKocJqj0CY00018b9f@hotmail.com> Hmmm. Seems like quite a debate has raged about the demo track releases. And just a few extra thoughts come to mind as a result of the correspondence. Now of course xtc arent forcing us to buy Homegrown and noone is holding a gun to our heads, but Im not sure that that is the point. In other words I would find it equally strange if xtc released every song from Wasp Star or whatever as a single. Now they wouldnt be forcing me to buy them but just the mere fact that they choose to do that I would disagree with. And of course xtc are artists and should be paid for what they do, but releasing a set of demos like Homegrown is similar to charging people to sit in rehearsals for a play or publishing the first draft of a novel complete with rewrites and editors notes. Surely it's the finished product that an artist sells and not the process that bought to fruition. popboy
------------------------------ Date: Mon, 4 Jun 2001 12:59:05 -0700 From: "Drude" <the-drude@home.com> Subject: More Metal and XTC Message-ID: <000201c0ed30$cf4829c0$6ec94518@gv.shawcable.net> I am a huge XTC fan. Have been since I first heard Drums and Wires back 'round 1980. I love pop, as long as it's in the rock vein...Weezer, Matthew Sweet, Sloan, Michael Penn, Grant Lee Buffalo are all fantastic in my books... However, since I was a young lad, I have loved heavy music. I first got into stuff like Van Halen and Iron Maiden as a teen, but then jumped backwards through history to Black Sabbath, Zeppelin and their ilk. Nowadays, though I will always love the 3-4 minute finely-crafted Blur or Travis song, my love of heaviness has not died. I can say that I still love Sabbath, and consider Nine Inch Nails, Marilyn Manson, Type-O-Negative, Kyuss and Monster Magnet amongst my favourite bands. Not to mention TOOL, who's new album, Lateralus (for those of you Prog-Rock minded people), is one of the greatest albums I have ever heard by ANYONE. The neighbours must get mighty confused when I throw on The Beatles or a bit of Simon and Garfunkel, and then follow that up with some Ministry or Queens of the Stone Age. The Drude
------------------------------ Date: Mon, 4 Jun 2001 13:11:27 -0700 From: "Drude" <the-drude@home.com> Subject: ES single version Message-ID: <000301c0ed32$8947b6a0$6ec94518@gv.shawcable.net> I, too, remember the single version of ES having Nearly Africa and NOT Yacht Dance on it. Strange... Just a note. While perusing a certain used record shop here in Victoria, British Columbia, I happened upon a strange CD version of ES. The cover art was atrocious, though not as bad as that lime-green version that's floating around out there... but, most notably, the back listed the SINGLE CD version of the tracks, but with MANY TYPOS and at least one track number missing! It also did not list any label or record company on it. The CD itself had the full double CD track listing, but I don't remember whether the order was correct. I didn't buy it as I was rather skint at the time, but it is still there, so later this week, I will grab it and list the oddities for the next Chalkhills Digest. Anyone else seen/have this one? The Drude
------------------------------ Date: Mon, 4 Jun 2001 13:36:23 -0700 (PDT) From: Dane Bramage <bramage64@yahoo.com> Subject: Under New Management...(Limited XTC Content) Message-ID: <20010604203623.24037.qmail@web10004.mail.yahoo.com> I'm almost positive that no one remembers me here, as it's been ages since I've posted anything, but here I am anyway crawling out from under my filthy rock like a pinch of dirt to say <Hello!> and announce that I have re-subbed to Chalkhills under my new nom-de-internet. No reason for the switch other than I was uncomfortable with receiving my digests at work...must get some work done while I'm there! Here are just a few items that stirred me to respond: >Meanwhile, I'm off to place an advance order on >Amazon.com for Andy Partridge's "Songs I Whistled In >the W.C." I heard it comes in a snazzy pale yellow >die-cut tissue paper envelope, yes, it tears easily, >but it looks cool in the store. > >-- Jessica LOL!! Well done madam!!! Kirk.Gill said: >There is only one reason that Andy et. al. (whilst >whistling in the shower) release items such as >Homegrown. Because some people might buy it. See, >they're musicians for a LIVING. They do it for love, >sure, but also because they want to MAKE MONEY. Absolutely! Another woefully starving musician (I had the pleasure of seeing perform just this weekend) is Stan Ridgway. His typically hilarious show banter usually includes a paean to the audience to visit the "swag counter" to buy merchandise - so that "I can get that shit outta *my house*..." He is currently making more off of HBO film scores than album sales these days. To reiterate the point already made ad nauseum: don't buy it if you don't want it... I haven't earned enough paper & iron to purchase the reissues - other stuff is currently higher on the priority list I'm afraid...I never said I was a completist anyway! I'm currently stuck in Cardiacs heaven, though, and threaten to wear the pits outta my discs through rigorous listening...THANKS, DOM!! Until next time, -Dane
------------------------------ Date: Mon, 04 Jun 2001 16:50:49 -0400 From: "Angie Hill" <thunderien@hotmail.com> Subject: R.E.M. and XTC Message-ID: <F43OJXsNQptgFrYILoy00010eaf@hotmail.com> Greetings fellow Chalkhillians! This is my first post here so bear with me. I just wanted to say, I have been both a rabid XTC and R.E.M. fan fer many years. And I noticed upon purchasing R.E.M.'s new release, Reveal, last month, that the song "Summer Turns To High" would fit right in on an XTC album. In fact, I double checked the cd player during that song to make sure I hadn't subconsciously slipped in an XTC cd. If anyone else out there got that impression, let me know! Here's some quick background on my journey with XTC by way of introduction. I first really got into XTC in the late 80's as I was beginning high school. I don't have quite all of their albums (missing White Music as it's been elusive stateside), and i don't have any vinyl or reissues. Although I did stumble upon the Dukes of Stratosphere cd several years ago and loved it. I also have the Hello club edition of Andy Partrige doing a short little ep that included a stripped down version of "Some Lovely". That's it for odd pieces fer me! I guess I have just never had the cash to be that rabid of a fan, lol. That and my kingdom for a record player that works! Anyhow, I have always had a place in my heart for XTC's off-beat yet catchy tunes. And so I am happy to have found this forum to discuss all things XTC with folks who are going to actually know what I'm talking about! Lookin forward to the next edition of the digest --- Angel Lilly
------------------------------ Date: Mon, 4 Jun 2001 16:09:00 -0500 From: "Richard" <rjpa1@home.com> Subject: Enough about Homespun/Homegrown! Message-ID: <005001c0ed3a$93b3e3e0$02081fac@verisity.com> (long) Let me try to end or at least illuminate the speculation and rationalization about the release of Homespun, Homegrown, Fuzzy Warbles and any soda can/shower recordings. Andy has been very surprised and pleased that there is so much interest in his "sketches" but is very disappointed at the lengths that people go to to get copies of demos especially in light of the fact that most are of substandard quality. It shouldn't be hard to rationalize that if people are clamoring and happy to get _anything_ related to the inception, progression and construction of the songs, they might be interested in acquiring a much cleaner copy from the source. With the exception of a few eBay attrocities, most of the demo tracks that any of you have have been acquired via trade or free. If you paid good money for them, goodnight, sucker. The "success" of a release is measured in quantity of units sold but there is a balance that must be considered. If you believe that your CD will sell 20,000 copies and have that many printed, you take a substantial loss when you only end up selling 5000. If you print up 5000 (obviously at a much higher "per unit" cost) and have to have three additional runs to meet the demand which climbs to 20,000, you have spent much more money on duplication than you needed to. That cuts into your profit. (Obviously the second scenario is much easier to accomodate than the first.) XTC is not printing 500,000 copies of Homespun. Probably more like 50,000. WORLDWIDE! They are tapping the market that WANTS that particular product and have no allusions about it charting, give it very little promotion and don't expect it to be a runaway best seller. It's a historical artifact that WE have made. "We made it" in that XTC would simply not have considered releasing it if there didn't seem to be a market. While this is an elaboration on the explanation that came directly from Andy, I honestly believe that he would agree with everything stated. It is not a Lennon rebellion against the suckers who would buy any and every noise he ever made (i.e., the "Life With The Lions" LP which included the track "Two Minutes of Silence" which was just that - BTW, did they get BMI royalties everytime a radio station went "dead air" for two minutes?). Andy, as far as I know, has no intention of releasing any inconsequential studio noodling. On the other hand, he does have a keen interest in providing his faithful listeners with the material that they have indicated they want. Let me dramatize this by informing you that when Becki di Gregorio wanted to cover "Susan Revolving", Andy response was (paraphrased), "...but it isn't finished. Let me finish the lyrics. ...and there should be a key change a the end!" Susan Revolving as it had been left was incomplete and there was no intention to ever release it. It ended up being dubbed and handed around on cassette until it ended up in Becki's hands. I even had to transcribe the existing lyrics and fax them to Andy! To his knowledge, he didn't have a copy anymore. If you don't want to buy Homespun, Homegrown or whatever, you are not one of the people it was made for and that's okay too. It does not diminish your value as a fan. You don't have to be a completist to appreciate XTC. I always like looking at the sketches and preliminary studies of artists completed works. It makes me realize that no matter how much I gush or fawn over a particular painting, novel, song or movie, that person is real, regardless of their motivation. They made changes in the middle of the process, they thought about the way their work was evolving and they did their best at making it what they thought it should be. Therein lies my value of Homespun. 'Nuf said. Cheers, Richard Pedretti-Allen
------------------------------
Date: Mon, 04 Jun 2001 17:20:30 -0400
From: Douglas Bailey <trystero@ne.mediaone.net>
Subject: Re: newsgrope
Message-ID: <5.1.0.14.2.20010604162322.01f5f1c0@pop.ne.mediaone.net>
>"Drude" <the-drude@home.com> writes:
>
>I would like to start a newsgroup on XTC and related bands. Is this viable?
>Would anyone go???
*I* would: I actually prefer newsgroups to the digest format.
There *is* actually an XTC newsgroup, but it has an unfortunate and
hard-to-guess name (alt.fan.andy-j-partridge) and, consequently, almost no
readership.
I'd rather have a nice obvious name like "alt.music.xtc", but have no idea
how to go about creating an alt group.
Sorry,
doug
--------------douglas bailey (trystero@ne.mediaone.net)--------------
please don't heed my shout; I'm relaxed in the undertow...
--xtc
------------------------------ Date: Tue, 5 Jun 2001 10:44:53 +1000 From: "Culnane, Paul" <Paul.Culnane@dcita.gov.au> Subject: AC? Message-ID: <EEAD847E742DD51196550000E896881D40DE9C@g5dccbr0ms01.dcita.gov.au> Twice I have now encountered this term, "AC". Chris Vreeland, in 'Hills # 34, has "the AC on full blast" in his car. On Soulwax's magnificent "Much Against Everyone's Advice" album (cheers Dom!), there is a hidden track at the start of the CD, in which reference is also made to driving along with the AC on. Please sate this old-fashioned luddite's curiosity, and pray tell: what is an AC? ~~PC
------------------------------ Date: Mon, 4 Jun 2001 21:03:59 EDT From: Seesaw@aol.com Subject: collecting XTC/blegvad/dave/misc Message-ID: <a7.ef7e5e2.284d89ff@aol.com> Hello everyone! It has been a long long time since I have posted. A few questions and ramblings.... Are most XTC collectors also collectors of the various XTC related session work they have done? I have always tried to pick up all of these various projects. I just got the most recent Peter Blegvad CD "Choices Under Pressure". The CD features re- recordings of his older songs as well as two new songs he co- wrote with Andy Partridge. They are "God Detector" and "Gigantic Eye". I have been playing the CD quite a bit and enjoy most of it, though I do admit I don't hear much of Andy's writting style in the two new songs. Favorite tracks so far are the remakes of King Strut (also co- written by Andy) and Daughter. What does everyone here think of the CD? Personally, I have been a fan of Blegvad's for many years. Now if someone will just re- issue "King Strut And Other Stories" I would be very pleased. They could even include "Peter Who" as a bonus track! Along these same lines, does everyone still collect Dave Gregory related releases now that he is no longer an XTC member? I have never collected Barry Andrews post XTC releases (or Terry's for that matter), but I have tried to pick up most of Dave's stuff. I have had to ask myself a tough question though. I have not heard any of the Dave session work have any distinctive Dave sound on it. Andy's session work is much more distinct. Is Dave just a very competent session man? Are there any of Dave's session work that you could tell he was playing on without having been told or read in the album credits? And if this is true, how much is he really missed from XTC??? Don't get me wrong, I have always loved Dave's playing and was sad to see him leave XTC, but how much of what he did was just playing what Andy told him to play? After all, look at how close a lot of the demos these past years have been to the finished product. Your opinions please... Has anyone heard the David James LP "Calculated Risk" that Dave is supposed to play on? It is listed on the Gregory site, but I have never heard of it. Was it just a local release? If anyone has this, please let me know. I have also never heard any of the following Gregory related stuff, and if anyone has heard them I would love to hear your opinions to see if they are worth checking out: Keiichi Suzucki- Original Soundtracks: The Music CD Scarlet- Chemistry Lullabies With A Difference (various artists) Does UK cassette singles of Mayor Of Simpleton and The Loving actually exist? I know US versions do and I have the King For A Day UK Cassette single. But I have never seen the other two for sale or anyone with them in their collection. Did someone just assume they existed because of the King For A Day issue? And lastly, I do agree that Homespun and Homegrown are a bit indulgent and really of interest only for die hard XTC fans. But I eagerly snap them up to support the band anyway I can (I am a die hard collector anyway). Plus in this day and age, everything, no matter how obscure, seems to come out on CD. Look at all the prog and psych re releases that have come out that only sold by the dozens when first released. Or all the live and out takes CDs of bands like Uriah Heep (yuck!), Deep Purple, T. Rex/Bolan, old obscure sound tracks, and zillions of releases of old obscure blues/vocals/jazz/early rock/etc. Also, I feel that if I am going to buy all the demo bootlegs that have come out, I owe it the band to buy the legal releases. Sorry to go on for so long. That's it for now. XTC collector/nut/fanatic P.S. Also listening to: Frank Black- Dog In The Sand Cinerama- everything Echo And The Bunnymen- Flowers Sarah Hamner Idle Wild- 100 Broken Windows Kinks- everything Syd Barrett- the new compilation Guided By Voices- Isolation Drills Lots more.....
------------------------------ Date: Tue, 05 Jun 2001 12:58:31 -0600 From: "Steve Oleson" <Steve.Oleson@oag.state.tx.us> Subject: Blighty? Blimey! Message-ID: <sb1cd78a.040@smtpgate.oag.state.tx.us> I hadn't heard the nickname "Ol' Blighty" before the last couple of Chalkhills. What does it mean? - The Texian
------------------------------ Date: Tue, 5 Jun 2001 23:06:34 +0100 From: "Belinda" <b.blanchard@btinternet.com> Subject: XTC ON UK TELLY Message-ID: <002401c0ee0b$c903e320$32777bd5@btopenworld.com> Hi gang XTC are listed as being on Top Of The Pops 2, which airs Wednesday 13th June, 6.00pm on BBC2, and is repeated the following Saturday at gawd knows what time. TOTP2 tends to be studio recordings, so we wonder what they will show! Happy Summer, Belinda!
------------------------------
Date: Tue, 05 Jun 2001 20:54:13 -0500
From: "vee tube" <veetube@hotmail.com>
Subject: Remastered 'Fab Four In Philly' (FREE! XTC CONCERT!)
Message-ID: <F269sxPCFj2AhGwEUJl00007c52@hotmail.com>
Before I get started, I'd like to extend a personal
thank you to Sir Demon Brown (who's band 'Elf Power'
just completed a 'smashingly fine' tour with "Guided
By Voices") for helping me share this truly fine XTC
concert with all of you.
THANX! SDB!
(If you know what's good for you, you'll include
a short 'thanx sdb' in your next post)
Thus having spoketh, I'm VERY HAPPY to present a
'remastered' version of............................
"The Fab Foursome In Philly"
http://www.orangetwin.com/drunken/fabfoursomeinphilly.html
This is a no BS/Porno/Pop-up fast server link!
NOTE: Those of you who snagged this gem from last years
IDRIVE should read the 'tech notes' below.
TECH NOTES:
1. Last years IDRIVE version was a straight rip from
my 'real' CD boot.
2. This version has been 'remastered' with SOUNDFORGE!
(the best 2-track digital audio editor upright
walking smelly monkey-oids ever created)
3. Last years IDRIVE version was encoded to MP3 at
128kbps. This one is 160kbps.
4. This version has been 'normalized' to 0dbfs.
5. A slight top end roll off was used on this version
as the original was a 'tad' bright.
I hope those of you who don't have an 'original' of this
most excellent performance enjoy enjoy these MP3s.
Once more, THANX SDB!
}---:)
------------------------------ Date: Wed, 06 Jun 2001 05:45:28 From: "Duncan Kimball" <dunks58@hotmail.com> Subject: "It's very niiice ... but he's already got one." Message-ID: <F1000YKpDS7hx27kBnc0001541c@hotmail.com> From: Kirk.Gill@equifax.com Re: I bought myself a..... >Is it "marketing manipulation" (hi Angie) to offer a product for sale? >Methinks not. Methinks YES! in this case, for several very good reasons. >In answer to Steve Johnson, who isn't interested in buying the >remasters, >and wonders "Is there something wrong with me?" - No, there >isn't. See, >it's all about having fun and loving music and enjoying >XTC. If only the record company drones thought that ... >For me, being able to listen to these recordings in as clear and clean >a >form as possible is a wonderful thing. Agreed. We all want that. Which leads me to think ... CDs came on the market in the early 80s, didn't they? So how come it's taken Virgin nearly TWENTY YEARS to get around to remastering these recordings properly? See below ... >Listening to my old cd of Drums and Wires and the new remaster back to > >back is a joy for me. But if you listen to the old disc and enjoy it >and >love it, then who's to say that there's something wrong? Again, >just >because they offer it for sale you have no specific obligation to >buy it! All very 'motherhood', but as I've said, it begs the question of WHY the record companies didn't remaster these recordings properly in the first place? Answer: (A) they are cheap, greedy bastards (B) they laugh at us (all the way to the bank) as we dutifully file in to buy the SAME PRODUCT TWICE (or three times, if like me you bought the LPs) Sorry to disillusion you, Kirk, but commerce is not a value-neutral activity conducted by selfless philanthropists. In the case of something like XTC, there can be no doubt any more that Virgin are targeting a known, specific market, and they KNOW these things will sell in viable commercial quantities. The question of freedom to buy or not to buy is moot, since they know that the nature of the market is that collectors WILL buy these things. Bottom line -- they would not REissue them if they didn't think they were going to sell. It's business, not a fishing expedition. Call me old-fashioned, but I consider this kind of thing as what might (very) kindly be termed a "sharp" business practice. Issuing these albums without remastering them for CD was, in my view, a form of fraud, since the company issued what was clearly a sub-standard product, even by the technical specs of the day when they were first issued on CD (ca. 1987?). To be fair, I thought the original CD issues were OK value for money in so far as they were mid-priced and included bonus tracks. But again I ask: why weren't they, or the Peter Gabriel catalogue, or anything else they are re-doing, properly remastered in the first place? And now that Virgin have sussed that: (A) XTC are doing very nicely thank you in their post-Virgin career (B) there is a thriving XTC fan community on the internet who can do most of the marketing for them (C) there is a viable collector's market for XTC reissues they have suddenly leaped onto the bandwagon, remastering not only the original albums, but also squeezing the very last drops of congealing blood from the lifeless, stinking corpse of XTC's Virgin contract, by extorting the demos boxed-set out of them. As Taffy Turner would say: "Surprising? Not really." Dunks
------------------------------ Date: Wed, 6 Jun 2001 14:05:59 +0100 (BST) From: Chris Clee <cmc@sanger.ac.uk> Subject: Re: SPOILER WARNING: Japanese reissues part 2 Message-ID: <Pine.OSF.4.21.0106061358320.30410-100000@piranha> mister/miss pledge Out of curiosity why didn't you simply record the original tracks in the original order and leave out the extras.....lots cheaper methinks, i mean these days you can even cutomise your own cd's on your pc :) still....i have a tight budget TGCCATCGGATCTCCTGCCTAGAGGAG
------------------------------ Date: Wed, 6 Jun 2001 08:36:30 -0600 From: "Angie Kelson Packer & Shaun Packer" <nick@aros.net> Subject: Partridge Manipulation Message-ID: <00dd01c0ee96$14846560$7a19adcf@packer> Thanks for the return comments about my question on Mr. Partridge's marketing ploy, or lack thereof. Is it really a marketing ploy? Truly? H-E double hot-sticks! I don't know. Don't care. But someone needs to ask the tough questions <G>. Come on, AP is brilliant. It would take no great leap of intellect to manipulate some of us. Just keep the music coming! And I do love hearing the demos. My top reactions to Homespun: -XTC: The reason compact disc was invented. -I'm sorry, you said Robbie who? Bono who? Moby who? -How can so many versions of the same song be so delicious? -Iiiiii'm the man who murdered preconceived notions about the value and place of so-called popular music. -Oh my! I ~can~ tell their voices apart. -I'm grinning and I can't stop! As for Marie's comments about Partridge manipulation, um, the unmentionable kind; so far as I can tell, you have to get in line! I think it starts in St. Andrews.<G> Partridge Manipulation?! Sounds like a massage technique, a band, or an ornithological crime. Speaking of bands...ick, bad segue-way there...any more news on young Star Park? Angie
------------------------------ Date: Wed, 6 Jun 2001 12:03:15 -0400 From: "Michael D. Myers" <mmyers@telcordia.com> Subject: A few thoughts Message-ID: <OFB8C2C9A7.E29A4967-ON85256A63.0055DF93@cc.telcordia.com> Chalksters and Chalkettes; I was sorting out my CD collection, and I realized that the XTC section is growing quite large. It made me wonder about picking up remastered copies of each new CD since I already have them all. Any hints about which are the best remastering job? I have heard that Drums and Wires as well as the Big Express now have especially superior sound over the "original" versions (those with the bonus tracks in the middle. Can anyone tell me where they found the best prices for these items in the USA? Thanks in advance. I found the recent discussions about the placement of the bonus tracks to be ironic. Some folks who apparently became familiar with the band in the last few years did so via the available CD versions rather than the original vinyl versions. Of course, when the band put the vinyl albums out, the track listing was as per their wishes. So when the record companies reissued these masterpieces without the band's involvement, they made the unusual decision to put the bonus tracks in the middle. Beats me as to why. They could have just left a 30-second break after the "real" last track so that the listener could understand that the "proper" album was complete, and that the listener could make a choice as to whether they wanted to continue to listen fo rthe bonus tracks. So the irony is that some newer fans are upset that the bonus tracks are now at the end (where they belong) because it makes the album sound different from the way they are used to listening to them, even though that is not what the band wanted. When an artist makes an album, part of the artistry is deciding on flow and sequencing. It is not to be hacked up by people outside the creativity circle. Imagine a company that makes prints of artist's work saying, "sorry, Mr. Picasso, we really needed to move that nose back to the center of the painting because it looks better there"............... Upcoming release news: for fans of powerful, melodic music such as XTC, you may be interested to know that there is a box set coming in the next few months from the late, great Jellyfish. The release will be 4 CDs including a ton of rare and/or unissued stuff (78 tracks so far), done with the full involvement of the band. You will be able to order it from NotLame.com (I have no affiliation, blah, blah, blah) and it is expected to be priced less than $60 US. Also coming is a Jeff Lynne 2-CD tribute, which may interest those of you who don't consider him to be an entity from the dark side (please review Chalkhills archives instead of starting another flame war about how he "overproduced" the Beatles anthologies). Some people who have contributed are the Hollies (yeah!!), Todd R, Matthew Sweet, Mitch Easter, Chris Stamey, Peter Holsapple, and hopefully Jason Falkner and Tal Bachman. A veritable goldmine of powerpop talent. I've also tremendously enjoyed Aimee Mann's "Bachelor #2", which features her usual great lyrics as well as a studio band with Jon Brion, Buddy Judge and Dan McCaroll, all from the Grays (another short-lived but great band to check out). Mike
------------------------------ Date: Wed, 6 Jun 2001 16:56:42 -0400 From: "Ted Harms" <tmharms@library.uwaterloo.ca> Subject: bonus sleeve Message-ID: <000201c0eecb$30b64fc0$953a6181@lib.uwaterloo.ca> So, greatly enjoying the remastered discs. The big surprise so far as been that inside my Go 2, I discovered a sleeve for Go+. Anybody know why the sleeve's in the package but the songs aren't? Ted Harms Library, Univ. of Waterloo tmharms@library.uwaterloo.ca 519.888.4567 x3938 "And who's teaching these monkeys how to fight?" Emily Litella
------------------------------ Date: Thu, 07 Jun 2001 11:43:26 -0000 From: "Tim Brooks" <bridgered@hotmail.com> Subject: (Hear it) Read It In The Sunday Papers Message-ID: <F238ZDgw0V8Lr28KUFc00002fcc@hotmail.com> (Hear it) Read It In The Sunday Papers Back after a lurking few months A very nice new trend in the UK is that the weekend papers are giving away CD samplers of bands as an advertising tool for both the paper and the band (or should I say record company). Recent examples include from the mega sellers Elvis, Bee Gees, Moby,Texas, Blur, U2 but also to smaller cult acts such as Nick Cave, Neil Finn, Deacon Blue and Divine Comedy. These discs typically have some greatest hits, a couple of tracks from the bands latest release, but also an unreleased track or live track and often a CD ROM section with old videos, interview etc thus making the discs highly collectible (just look on EBAY). The paper has an interview/review and a voucher for money off the latest relese or back catalogue. I was just thinking what a great "idea" it would be to remind Joe Public of the continuing existance of our heroes if Virgin at the time of the box set did one of these to push the remasters release, and CV/IDEA joined in (as with the Deacon Blue disc) to show band is still going strong today. How about this for a tracklisting : Nigel Senses Grass Chalkhills + Children I'd Like That Stupidly Happy Box set demo CD ROM : Dear God video Disapointed video Yeah I know I'm dreaming and that Idea probably could'nt afford it, but Virgin and CV? especially as their is obviously still co-operation between band and old label (albeit reluctant) I can still dream. Out of interest do the papers in the States do such freebies?? Tim "Drowning in a Summers Cauldron" lyrical challenge Read It In The Sunday Papers
------------------------------ Date: Thu, 07 Jun 2001 11:44:09 -0000 From: "Tim Brooks" <bridgered@hotmail.com> Subject: UNCUT Message-ID: <F1566LCFeXumoLIH24W00009e44@hotmail.com> Probably 5th person to say this but this months UNCUT magazine is simply unmissable. A 50th edition celebration, printed with 4 covers each with a Beatle (yeah I know Mojo have done this before and are even doing it for the third time this month as well) but UNCUT also has an amazing 24 track CD of Beatles covers (presumably unavailable in US?) and our Andy is also featured, as part of a panel picking best ever song. Andy comments on Rain and closes with a typical Partridgism that he couldn't understand why the backwards vocal part has the band singing about his mum brand of hair restorer "Nair". lyrical challenge : tore up all your photos didn't feel too clever spent the whole of sunday sticking you together (great original, even better challenge)
------------------------------ Date: Thu, 07 Jun 2001 14:18:18 +0200 From: art et affiche <art.affiche@wanadoo.fr> Subject: XTC on french radio Message-ID: <3B1F710B.5D3FDC3F@wanadoo.fr> Hello, a special post for french Chalkhillers, or for those who can hear french radio thanks to satellite : Les XTC seront les invites de Bernard Lenoir sur France Inter le jeudi 14 juin a partir de 21h30 ! Our dear Colin and Andy will be on promo tour next week on the continent, and particularly in France (Paris). They will be guest by B. Lenoir in France-Inter (a radio equivalent to BBC in France) on Thurday June 14, at 21.30 PM. Get the info at: http://www.radio-france.fr/chaines/france-inter/lenoir/index.php. I'll try to tape this- Marie Omnibus.
------------------------------ Date: Thu, 7 Jun 2001 14:56:05 -0400 From: "Michael Versaci" <mwversaci@att.net> Subject: Atlanta Venus Vol. III Message-ID: <000101c0ef83$819d5560$0d01010a@tornbmv> Folxtc, Pete Roberts and I have chosen a date for the 3rd (almost) Annual XTC Hot 'Lanta Summer Celebration. It will be on Saturday, July 28th, 2001. The festivities will commence at around 2:00 P.M. and will be held in the L5P region of Atlanta. E-mail me or Pete [pete_srd@mindspring.com] off-list for more details. Michael Versaci
------------------------------ Date: Thu, 07 Jun 2001 17:58:31 -0400 From: "Robert C. Miner" <minerr@bc.edu> Subject: Trip to Swindon Message-ID: <SIMEON.10106071731.A@muahost.bc.edu > Dear Chalkhillians, I am making an academic research trip to the UK during the first week of July. It so happens that I may be passing through Swindon. While there, I would love to talk to AP or CM. Not for the usual 'fan reasons' -- although I happily admit that I am a huge fan -- but because I'm a professional philosopher with a growing interest in aesthetics. I would *love* to chat with Andy and Colin about things like songwriting, the relation between creation and technical production, the nature of truthfulness in art, and other issues that arise in aesthetics. I'm not looking for a developed theory from them (that's the philosopher's job, isn't it?), but for the sort of intuitions that lie at the base of any worthwhile theory. Frankly, I can't think of anyone whose intuitions in this area I'd rather have. Oddly enough, it hardly ever occurs to ivory-tower academics to speak with persons who have actual practical competence (let alone excellence) in the field of their inquiry. Thus we get the familiar but sad spectacle of the tidy-minded philosopher who is adept at "talking sense but not knowing what he is talking about," as R.G. Collingwood writes in the *Principles of Art*. (The inverse is the kind of artist capable of "knowing what he is talking about, but talking nonsense.") If anyone wants to pass this on to AP or CM, on the slight chance that either would be interested in an informal discussion of such things with me, please let me know. Although I am a 'credentialed philosopher,' I'm not too much of an asshole or know-it-all. Particularly when it comes to art, I have lots of questions, but virtually no answers. Philosophers have an unfortunate (but often deserved) reputation of using the tools of logic and argumentation as a stick with which to beat their interlocutors. I'd like to think I'm not like that. Enough babbling. If anyone has any input or advice, please let me know. Robert C. Miner (Boston College, Department of Philosophy)
------------------------------ Date: Thu, 7 Jun 2001 16:29:14 -0600 From: "Angie Kelson Packer & Shaun Packer" <nick@aros.net> Subject: Homegrown Message-ID: <002d01c0efa1$48b57ac0$6818adcf@packer> Akkk.... Top reactions to Home*grown* I meant Home*grown*. Although yes, Homespun is a fine addition to any collection. Gotta hope XTC doesn't come out with: Home Canned Home School Home Baked (as opposed to half-baked) Home Repair Home Office not to mention Home Pregnancy Test! Lord, what fools this mortal be...or something like that. Angie
------------------------------ Date: Fri, 8 Jun 2001 17:45:21 -0700 (PDT) From: pancho artecona <partecona@yahoo.com> Subject: Re: Issues Message-ID: <20010609004521.79379.qmail@web10405.mail.yahoo.com> Well I am heartily pleased with all the reissues. The main thing with me is the SOUND, although the original packaging and song order is a boon. And as an added bonus I've been able to use my old magnifying glass again. I'd never heard all those kids in the background in 'The Everyday Story of Smalltown'....all of BE really comes alive actually. Oh well that's this world over Pancho XPRXTCFAN
------------------------------ End of Chalkhills Digest #7-35 ******************************
Go back to Volume 7.
9 June 2001 / Feedback