Chalkhills Digest, Volume 7, Number 45

                  Sunday, 5 August 2001

Topics:

                       nautical XTC
                     Don't do it John
                       Re: CD Rack
                   Re: Strawberry Yoga
                         Hi Guys
                    Damn the torpedos!
                       flying pigs
                 Japanese remasters in Oz
Re: Me showing off (for everyone who didn't see it on alt.music.xtc)
Re: Me showing off (for everyone who didn't see it on alt.music.xtc)
       Re: Skylarking Order (My ten cents worth...)
                         Fug you!
                        Royalties
                     the ebb and flow
                       Andy vs Blur

Administrivia:

John Relph will be on vacation from August 6 to August 19, 2001.
(Bungalow by the sea.)  Chalkhills will be off the air during
that period.  Thank you for your patience and understanding.  

    To UNSUBSCRIBE from the Chalkhills mailing list, send a message to
    <chalkhills-request@chalkhills.org> with the following command:

        unsubscribe

    For all other administrative issues, send a message to:

        <chalkhills-request@chalkhills.org>

    Please remember to send your Chalkhills postings to:

        <chalkhills@chalkhills.org>

    World Wide Web: <http://chalkhills.org/>

    The views expressed herein are those of the individual authors.

    Chalkhills is compiled with Digest 3.7d (John Relph <relph@tmbg.org>).

Watching and waiting by the sea.

----------------------------------------------------------------------

Date: Wed, 01 Aug 2001 22:59:37 -0400
From: Virginia Rosenberg <vmr423@earthlink.net>
Subject: nautical XTC
Message-ID: <B78E3A59.406%vmr423@earthlink.net>

Okay, it may not be nautical in a very technical sense, but "Desert Island"
would, I think, sound very nice on a nautically-themed mix.

Mark, your door carvings are beautiful- happy birthday, indeed!

John, hope you have a lovely (Unix-free) holiday by the sea.

If anyone out there has been considering giving Joe Henry's newest ("Scar")
a listen, my advice is "go ahead and jump": it's brilliant. Am also
listening to a lot of Arto Lindsay these days- esp. "Prize"- I like it a
lot!

Also, last I checked, half.com had both the "Song Stories" and the
"Chalkhills" books on hand at reasonable prices. In no way affiliated, etc.,
etc. If you don't live in the States, this info isn't likely to help you
much unless you have friends/relatives in the U.S. who are willing to help
you out...

Regards,
Virginia

------------------------------

Date: Thu, 2 Aug 2001 09:52:04 +0100 (BST)
From: Chris Clee <cmc@sanger.ac.uk>
Subject: Don't do it John
Message-ID: <Pine.OSF.4.21.0108020948030.22090-100000@piranha>

Keep the UNIX box, don't touch windoze........the worst operating
system in the world ;)

if you do buy a PC use linux, you'll like it more, (there again you
already know that:)

laters

TGCCATCGGATCTCCTGCCTAGAGGAG

------------------------------

Date: Thu, 2 Aug 2001 10:11:47 +0100
From: "Chris Wright" <PLUChris1@cs.com>
Subject: Re: CD Rack
Message-ID: <00f901c11b33$295edf50$a20d01b6@it12>

Mark Wotton wrote:
> I turned 22 recently, and my girlfriend made me something fairly cool.
> There's only one picture of it so far, and it doesn't show all the
> carvings, but I think it's pretty cool. Check it out and tell me what you
> think:
>
>         http://www.cse.unsw.edu.au/~mwotton/madcdstand.jpg

OK!  That's just about the greatest CD rack in the history of the world!!!

PLU

Chris

She held his head like a baby's and said "It's OK if you cry!"

------------------------------

Date: Thu, 2 Aug 2001 08:24:01 -0400
From: "Brian" <mattone@bhip.infi.net>
Subject: Re: Strawberry Yoga
Message-ID: <003c01c11b4e$044def60$2843193f@Brian>

Tschalkgerz!

>Whaddya think the chances are of Colin or Dave teaching a yoga class?<

None, I'd hope.
As much as yoga is probably beneficial as some sort of exercise regimen, I
flinch at the New Age aspects that are dragged along with it.

-Brian Matthews
http://www.stonetrek.com
"People are entitled to their own opinions, but not their own facts."

------------------------------

Date: Fri, 3 Aug 2001 00:00:30 +0100
From: "David Valentine" <david@valentined.freeserve.co.uk>
Subject: Hi Guys
Message-ID: <005301c11ba6$f1045a80$db94893e@ddd>

Hi There,

There are a few fans who are considering setting up our own Yahoo group.

This is not a reflection of the XTC scene or the superb work that Chalkhills
does.

It's just that we are pretty much novices of XTC. Fans since the beginning
who would like to feed of one and another. Typically the members wou;d have
all the official stuff and a few boots.

But they would not be into collecting all memorabila and foreign singles
etc.

I don't think that there is a group for this, if there is please let me
know.

The main group is really for serious collectors and we would be lost in that
field.

Ideally it would be a sister group to Collect XTC or something.

It doesn't need to be a news thing, you do that admirably.

More of a chatty thing of like minded fans about all sorts. Centring around
XTC.

It may be that a few boots are swopped, but nothing like the dedication
shown by Collect XTC.

Just asking for your valued opinion.

Don.

------------------------------

Date: Thu, 2 Aug 2001 19:39:04 EDT
From: KINGSTUNES@aol.com
Subject: Damn the torpedos!
Message-ID: <97.1925b410.289b3e98@aol.com>

>>XTC music with reference to or inspired by things nautical..

While it's not an XTC song, One Of Our Submarines on Thomas Dolby's The
Golden Age of Wireless features Andy's patented synthesized sub radar sounds.

Yer humble ecsty sea fan, TK %-)  (blub!)

------------------------------

Date: Thu, 2 Aug 2001 21:32:11 -0000
From: "Lisette Proulx" <lisette@quatuor.cc>
Subject: flying pigs
Message-ID: <MABBJIHPPJAOOLFFFLDHKEDCCCAA.lisette@quatuor.cc>

dear chalkaliens,

what does "flying pigs" means ?
we find it in a few XTC songs: In another life. My brown guitar) and i can't
figure it out...

lisette

------------------------------

Date: Fri, 03 Aug 2001 13:09:17 +1100
From: SEBASTIEN MAURY 02 9950 3315 <maury.sebastien@abc.net.au>
Subject: Japanese remasters in Oz
Message-ID: <200108030305.NAA0000002961@inmail01.abc.net.au>

Much as I hate to recommend HMV....I would like to point out that they
appear to have *some* stock of the Japanese remasters, and, as always,
their prices, although inflated, aren't as hiked up as Red Eye.
You must understand I love Red Eye, and in fact just bought 2 CDs there
(hi!) but I put this information out there for those who may chose to be
more budget conscious than me...

Cheers

Seb
PS geez the packaging is fantastic: I picked up BE and BS.

------------------------------

Date: Fri, 3 Aug 2001 11:23:08 +0200
From: "Andre Koning-de" <a.de.koning@bp.vnu.com>
Subject: Re: Me showing off (for everyone who didn't see it on
Message-ID: <OFB9E4212E.FCED7F26-ONC1256A9D.0032EA1B@bpa.vnu.com>

alt.music.xtc)
Mark Wotton wrote:

>I turned 22 recently, and my girlfriend made me something fairly cool.
>There's only one picture of it so far, and it doesn't show all the
>carvings, but I think it's pretty cool. Check it out and tell me what you
>think:
>
>        http://www.cse.unsw.edu.au/~mwotton/madcdstand.jpg

Just _fairly_ cool?? Only _pretty_ cool??? No man, it's AWESOME!

Obviously, you're not worthy of your girlfriend. She's a genius.

Andre

------------------------------

Date: Fri, 3 Aug 2001 19:44:42 +1000 (EST)
From: Mark Wotton <mwotton@student.usyd.edu.au>
Subject: Re: Me showing off (for everyone who didn't see it on
Message-ID: <Pine.LNX.4.21.0108031943350.7228-100000@wotbox>

alt.music.xtc)
On Fri, 3 Aug 2001, Andre Koning-de wrote:

> Mark Wotton wrote:
>
> >I turned 22 recently, and my girlfriend made me something fairly cool.
> >There's only one picture of it so far, and it doesn't show all the
> >carvings, but I think it's pretty cool. Check it out and tell me what you
> >think:
> >
> >        http://www.cse.unsw.edu.au/~mwotton/madcdstand.jpg
>
> Just _fairly_ cool?? Only _pretty_ cool??? No man, it's AWESOME!

I didn't want to blow her trumpet too hard. Of course, I think it's
wonderful.

> Obviously, you're not worthy of your girlfriend. She's a genius.

I know. Please don't tell her.

mrak

--
normalise the signal and you're banging on freon
paleolithic eon, put the fake goatee on
and it booms as cool as sugarfree jazz
	-- Soul Coughing, Sugarfree Jazz

------------------------------

Date: Fri, 3 Aug 2001 10:55:29 -0700
From: "Drude" <the-drude@home.com>
Subject: Re: Skylarking Order (My ten cents worth...)
Message-ID: <001301c11c45$7be4d500$07b44118@gv.shawcable.net>

Personally speaking, I LIKE Dear God at the END of Skylarking...

I had the vinyl with it in place of Mermaid, but I live in Canada and every
copy of the CD I've ever owned has had Dear God as the last track.  But,
despite this, I think considering the 'concept' or 'song cycle' idea, it
fits most appropriately at the end, and makes a nice little epilogue to the
'life in one day' concept...

Just my opinion of course...

Drude

------------------------------

Date: Sun, 5 Aug 2001 15:06:52 -0500 (CDT)
From: Brown <i.sundog@verizon.net>
Subject: Fug you!
Message-ID: <200108052006.PAA157807900@smtppop1pub.verizon.net>

Attention fugs fans-

<<An Individually Numbered Limited Edition Of 5,000 (Five Thousand) Copies
of THE FUGS 'Electromagnetic Steamboat: The Reprise Recordings'.
Pre-orderable Now For Shipments Beginning 12 September 2001.

56 Tracks (Including 5 Previously Unreleased)  A 3-CD Set With A 24-Page
Booklet.>>

Catalogue Number:
RHM2 7759

$49.98

http://www.rhinohandmade.com/RHIP/7759/index.html

I thought some of you kids might be interested.

C-U!

Debora Brown

--Richard, I am working on getting you one helluva deal on a three day
'Forrest Tucker' fun package.. stay tuned. ;-)

------------------------------

Date: Sun, 5 Aug 2001 18:51:59 -0500
From: "Richard" <rjpa1@home.com>
Subject: Royalties
Message-ID: <098601c11e09$9e45d480$04081fac@verisity.com>

Randy asked: "...but in light of all the band's legal and financial problems
with Virgin, what about the royalties? Will buying these albums in the
re-mastered versions just screw Andy & Colin? If so, I advocate a boycott!"

Buying the new versions do not hurt Andy and Colin.  They do get some money
but not much because they signed a bad contract - way back when.  They
didn't get much money from any Virgin release before and you bought them...
should that stop you now?

I say, buy them if you want them.

Richard

------------------------------

Date: Sun, 5 Aug 2001 21:39:23 -0500
From: "Jamie Lowe" <jamielowe@msn.com>
Subject: the ebb and flow
Message-ID: <005201c11e21$21d5d360$ac78393f@unlpm>

Dear Chalkholders,

Thanks to all who have contributed to my quest for the most complete
nautical Xtc compilation.  In #7-44 Nathan Mulac DeHoff quite rightly nailed
me on my addition of " No Language In our Lungs" for lacking a connection.
I was certain that the lyrics were "I felt just like a SAILOR", but a check
of the lyrics and it is a "Crusader" .....Black Sea is one of my favorites
albums and yet with it's Nautical cover and title that's where the
connection ends.  I stand corrected!  In addition,  Nathan also pointed out
that "Brainiac's Daughter," for its reference to "a sleigh ride underwater,"
and various watery sound effects?  "Wounded Horse" mentions a ship.  "The
Somnambulist" compares sleepwalking to deep-sea diving.  Are excellent
recommendations, many thanks for your erudite suggestions.  They will be
added.

Also,  eriC draveS cast some light (house) with these entries...

20. RIVER of Orchids.  This works in a Joseph Conrad kind of way...

21. Great Fire Burning ("Bring WATER") This is a stretch...

22. Bungalow ("By the SEA").  This is good...

23. Rook ("Gaze in the BROOK")   Brooks are not considered as navigable
waterways sorry...

24. Ballet for a Rainy Day ("See the colors of the SEA fall on the rooftop")
Certainly acceptable...

25. 1000 Umbrellas ("I cried 'til I floated DOWNSTREAM") A definite maybe...

26. Yellow Submarine, etc. :)  Bonus track possibility :)

And Tyler Hewitt emailed directly and suggested "Shore Leave Ornithology"
from the Explode Together cd (originally on the Mr. Partridge lp "Take
Away/The Lure of Salvage")  can certainly be included.  This is one album
that does not get very much attention in theses here hills probably because
it is such a departure from the rest of the catalogue.  However, after I
listened to the aforementioned track recently, I must admit that it seems
worth another look/listen at what is just another facet of the genius we all
love.

 Thanks to all for your help. More recommendations are welcome, and as I
said before a nautical XTC compilation maybe in your future if you can add
to this collection.

 I am off for a week in Pentwater, Michigan on the lovely shore of Lake
Michigan with the family.  Before you know it the summer of 2001 will just
be a fond memory.

Cheers,

Jamie Lowe
Chicago

------------------------------

Date: Mon, 6 Aug 2001 14:57:35 +1000
From: "Culnane, Paul" <Paul.Culnane@dcita.gov.au>
Subject: Andy vs Blur
Message-ID: <EEAD847E742DD51196550000E896881D40E05F@g5dccbr0ms01.dcita.gov.au>

Chalk-talkers:

A friend of mine was inquiring about the availability of the recordings that
Andy produced for Blur.  These tapes were supposed to form the basis of the
"Modern Life Is Rubbish" album, but were scrapped.

Has anybody got a copy of these recordings?  If so, I would love to obtain a
copy!  I have a vast array of XtC material that I could offer as a trade.

Please email me off-list if you are in a position to help.

Many thanks
Paul Culnane
Canberra, Australia

------------------------------

End of Chalkhills Digest #7-45
******************************

---

Go back to Volume 7.

6 August 2001 / Feedback